मंथन डेस्क

PATNA:लगता है असद उद्दीन ओवैसी ने राजद की नींद हराम करने की ठान ली है.भाजपा का एजेंट कहने से उन पर कोई असर नहीं पड़ रहा है.बल्कि ओवैसी ने इसे गम्भीरता से ले लिया है.कुढ़नी विधानसभा उपचुनाव में उम्मीदवार देने से पहले एआइएमआइएम ने पटना यूनिवर्सिटी का छात्रसंघ चुनाव को दिलचस्प बना दिया है.पार्टी ने सबा क़ुतुब पर दांव खेल दिया है.ओवैसी की सिपहसलार सबा उपाध्यक्ष पद की उम्मीदवार है.19 नवंबर को होना वाला चुनाव के लिए नामांकन की अंतिम तिथि को ओवैसी की पार्टी ने चुपचाप अपना उम्मीदवार मैदान में उतार दिया.जिससे बिहार में सियासत की नर्सरी कहे जाने वाली पटना यूनिवर्सिटी का चुनावी माहौल अचानक गरम हो गया है.

नामांकन के बाद सबा क़ुतुब को गोद में उठाती समर्थक

गोपालगंज में राजद की शिकस्त की वजह बनने के बाद ओवैसी की पार्टी का हौसला इतना बुलंद है कुढ़नी में भी उम्मीदवार देने का एलान कर दिया है. कहा जा सकता है कि एआइएमआइएम तेजस्वी यादव के पीछे पड़ गए है.यह बात बिहार की सियासत में चर्चा का विषय बना हुआ है.ओवैसी बिहार की राजनीति में तेजी से अपने पैर पसार रहे हैं.इससे उपमुख्यमंत्री तेजस्वी यादव की पार्टी राजद की मुश्किलें बढ़ गई हैं.विधानसभा उपचुनाव में तेजस्वी का खेल बिगाड़ने के बाद अब ओवैसी की पार्टी एआईएमआईएम ने पटना यूनिवर्सिटी के छात्र संघ चुनाव में भी एंट्री मार ली है.पार्टी ने सबा कुतुब को उपाध्यक्ष पद का प्रत्याशी बनाया है.सबा एमएससी सांख्यिकी की छात्रा हैं.

चुनाव प्रचार करती सबा क़ुतुब

पीयू छात्र संघ का चुनाव परिणाम कुढ़नी उपचुनाव पर भी प्रभाव डालेगा.एमआइएम के प्रदेश प्रवक्ता आदिल हसन आज़ाद ने समय मंथन को बताया कि पीयू में मुक़ाबला दिलचस्प होगा और उसके बाद कुढ़नी में नज़ारा बदल जायेगा.जल्द ही कुढ़नी के लिए प्रत्याशी की घोषणा की जायेगी.चुनाव लड़ना तय है.सन ऑफ़ मल्लाह,सन ऑफ़ यादव तो सन ऑफ़ सिमांचल क्यों नहीं हो सकता है,सन ऑफ़ मुसलमान क्यों नहीं हो सकता है.राजद को पार्टी तोड़ने का शौक़ है तो बैरिस्टर ओवैसी और अख़्तरुल ईमान ने भी ठान लिया है एमआइएम को कैसे आगे बढ़ाना है और इसके लिए हर जतन किया जायेगा.सबा क़ुतुब पीयू की लोकप्रिय छात्रा हैं.चुनावी नज़ारा बदल कर रख देगी.

सबा क़ुतुब एमआइएम के प्रदेश अध्यक्ष अख़्तरुल ईमान और प्रवक्ता आदिल के साथ

सबा कुतुब का मुकाबला वैसे तो एबीवीपी, एनएसयूआई, छात्र जदयू समेत सभी छात्र संगठनों से होगा.मगर असल में खेल राजद का ही बिगाड़ेगी.क्योंकि,राजद का कोर वोटर यादव के साथ मुसलमान भी है.मुसलमानों पर ओवैसी का भी फ़ोकस है. यदि सबा कुतुब मुस्लिम छात्रों को रिझाने में सफल हो गयी तो छात्र राजद के वोट छिटक सकते हैं.ऐसे में छात्र राजद को बड़ा नुकसान उठाना पड़ सकता है.गोपालगंज उपचुनाव के नतीजों को देखें तो साफ पता चलता है कि एआइएमआइएम द्वारा मुस्लिम वोटबैंक में सेंधमारी के कारण राजद उम्मीदवार की हार हुई.ऐसे में कहा जा रहा है कि आने वाले समय में तेजस्वी के लिए ओवैसी नई चुनौती बनकर उभरने वाले हैं.

By admin

1,337 thoughts on “अब ओवैसी की सिपहसलार सबा कुतुब ने बढ़ायी तेजस्वी की चिंता. . .दिलचस्प हुआ पीयू चुनाव”
  1. The pathologist now plays an integral part in helping the oncologist choose the right therapy for his patient, and the right patient gets the right drug at the right time, which hopefully will reduce the use of expensive chemotherapeutic agents as well as reduce the significant risk they present levitra cuanto cuesta To detect human SAP 1, a human SAP 1 specific probe was prepared by PCR using the forward primer CCTCTAATGATGGGCAGTTTAAGCT SEQ ID NO 4 and the reverse primer TTTGTCATAATTCATGTTAGGCTTGTTC SEQ ID NO 5

  2. priligy dapoxetine 60mg It must be understood first and foremost that Deca Durabolin side effects include side effects that are unique to Nandrolone and unseen with nearly all other anabolic steroids with the exception of its brother compound, Trenbolone, which shares many of the exact same side effects and properties

  3. 💫 Wow, this blog is like a fantastic adventure launching into the galaxy of excitement! 💫 The mind-blowing content here is a thrilling for the imagination, sparking awe at every turn. 🌟 Whether it’s lifestyle, this blog is a treasure trove of inspiring insights! #MindBlown Dive into this exciting adventure of knowledge and let your imagination roam! ✨ Don’t just read, experience the thrill! 🌈 Your brain will be grateful for this exciting journey through the dimensions of awe! ✨

  4. My brother recommended I may like this blog. He was
    totally right. This put up truly made my day. You
    can not consider simply how a lot time I had spent for this info!
    Thanks!

    Here is my web blog – wa slot togel

  5. I urge you stay away from this site. The experience I had with it was only disappointment as well as suspicion of deceptive behavior. Exercise extreme caution, or better yet, find an honest site to fulfill your requirements.

  6. I urge you stay away from this site. My own encounter with it was nothing but disappointment as well as concerns regarding deceptive behavior. Be extremely cautious, or better yet, look for a trustworthy service to meet your needs.

  7. I strongly recommend to avoid this platform. My own encounter with it was purely dismay as well as concerns regarding deceptive behavior. Exercise extreme caution, or alternatively, seek out a more reputable platform to meet your needs.

  8. I highly advise steer clear of this site. My personal experience with it was nothing but disappointment and doubts about deceptive behavior. Proceed with extreme caution, or better yet, find a more reputable service to meet your needs.

  9. I highly advise steer clear of this site. The experience I had with it was only frustration and concerns regarding scamming practices. Exercise extreme caution, or alternatively, look for an honest site for your needs.

  10. I urge you steer clear of this platform. My own encounter with it was nothing but frustration and suspicion of deceptive behavior. Exercise extreme caution, or better yet, look for a trustworthy site to fulfill your requirements.

  11. I strongly recommend stay away from this platform. My personal experience with it has been nothing but frustration as well as concerns regarding deceptive behavior. Proceed with extreme caution, or better yet, seek out an honest service for your needs.

  12. I strongly recommend stay away from this platform. My own encounter with it has been purely frustration and concerns regarding deceptive behavior. Exercise extreme caution, or better yet, look for a trustworthy service to fulfill your requirements.

  13. I urge you to avoid this platform. My own encounter with it was nothing but dismay along with concerns regarding scamming practices. Be extremely cautious, or even better, look for an honest platform to meet your needs.

  14. I strongly recommend to avoid this platform. The experience I had with it has been only dismay and concerns regarding fraudulent activities. Be extremely cautious, or better yet, look for an honest service to meet your needs.

  15. I highly advise to avoid this site. My personal experience with it has been purely disappointment along with doubts about deceptive behavior. Proceed with extreme caution, or even better, find a more reputable service to fulfill your requirements.

  16. I highly advise stay away from this platform. My own encounter with it was only dismay along with suspicion of fraudulent activities. Proceed with extreme caution, or even better, seek out a trustworthy platform to fulfill your requirements.

  17. I highly advise stay away from this site. My own encounter with it has been only disappointment as well as suspicion of fraudulent activities. Exercise extreme caution, or better yet, look for an honest site to meet your needs.

  18. I urge you steer clear of this site. The experience I had with it has been purely frustration as well as doubts about deceptive behavior. Exercise extreme caution, or better yet, find a trustworthy site for your needs.

  19. I urge you to avoid this site. My personal experience with it was purely disappointment as well as suspicion of deceptive behavior. Exercise extreme caution, or alternatively, look for a trustworthy platform to meet your needs.

  20. I urge you stay away from this platform. My personal experience with it has been nothing but disappointment and doubts about deceptive behavior. Proceed with extreme caution, or even better, find an honest service to meet your needs.

Leave a Reply

Your email address will not be published.